Representative marine algae image — not this exact specimenMarine algae

Marine algaeOn request Demonstration data

Sargassum ilicifolium

Sargassum seaweed

Accession: OMN-MAR-0030

Family: Sargassaceae
Category: Marine algae
Geographic origin: Ras al Jinz, Ash Sharqiyah
Sampling depth: 2.1 m
Collection date: 2016-05-18
Holding institution: National Heritage Collection (Demo)

Overview

Scientific identity

All values on this page are synthetic demonstration data, generated for this prototype.

Taxonomy

ChromistaOchrophytaPhaeophyceaeFucalesSargassaceaeSargassumSargassum ilicifolium

Thallus form

Leathery, branched thallus with air bladders.

Colour

Olive-brown

Holdfast

Attached to rocky substrate by a discoid holdfast (recorded at sampling).

Resource network

This record

OMN-MAR-0030

Each node jumps to its section on this page.

GIS & sampling

Sampling location & depth

Where this organism was collected, and at what depth in the water column.

Loading map of Oman…

Ras al Jinz, Ash Sharqiyah · Exposed rocky coast · 10 records of this speciesOpen geographic explorer

Sampling depth explorer

0 m50 m

2.1 m · this record

0 m50 m

1.1 m

0 m50 m

9.8 m

0 m50 m

11.4 m

0 m50 m

1.5 m

Recorded depth: 2.1 m
Sampling method: Snorkelling / intertidal collection

Schematic depth scale — no bathymetric profile is claimed. Other columns are recorded depths of the same species (demo).

Environment

Water conditions at sampling

Single set of measurements recorded during the sampling event on 2016-05-18 — not a monitoring series.

Water temperature

26.5 °C

Recorded at sampling · Ras al Jinz, Ash Sharqiyah

Sampling depth 2.1 m · Snorkelling / intertidal collection

Values are synthetic demonstration measurements with realistic units; no time series exists to chart.

Biochemistry

Extract & compound explorer

Select an extract to see its fractions and any assay results. All entries are synthetic demonstration data — no bioactivity is claimed.

OMN-MAR-0030→EXT-0030-M→CPD-0030-1→1 assay

Isolated fractions · EXT-0030-M

Polar fraction from liquid–liquid partitioning. Structural elucidation pending — no formula or structure is claimed.

Bioactivity assays

Antibacterial screening (disk diffusion)

ASY-0030-1

Target: Reference bacterial panel

No inhibition zone recorded

Negative result at tested concentration (demo). No bioactivity is claimed.

No chromatograms or spectra are held for these extracts, so none are drawn. Compound identities, formulas and structures remain unclaimed until characterization is complete.

Genomics

Genomic data

DNA barcodes and sequence records linked to this specimen. Sequences are synthetic demonstration output, not real results.

DNA barcodeBOLD:DEMO0030· demonstration barcode identifier, no external database record

Molecular markers

Sequenced (demo)

Marker: RuBisCO large subunit
Type: Plastid barcode
Sequence ID: OMN-MAR-0030_rbcL
Length: 550 bp

Synthetic demonstration sequence — not a real sequencing result.

Sequence viewer · rbcL

1TTTACCTCATGATAAGACACGAACAAGCTCGCCTAGCTATATCCGGAGCATGCGATATGG

61GAGTTACTTTACATAACCCAGGAAAGCTTAGGGAAGCTCTGGGCGCCACGTTGACAACAA

121GCGGCGGGACTACCAGAGCCATGGGTCCAAGAATCCTATAAATAAGGGGGACTGGTGCCT

181ACCAAAATGATTTTATATTGTGGTGTGAGCATGTCTCTTTGATAGATCAATCGAACCTGG

241CACCTTGATGGAACTACATTAGAGAAAGTTCATAGGTCTAGACGCACCAGTTGCGCTGCA

301CCAGGTTCTTCAGTTGACGCTGACCATCGATATTCTCCTTGGCACCAAGAGTGCGCTCTG

361ACGCCTTGACGCTTACATCCCGTATCCATTACGCTTATGGTGTGAAGAACCTTCCTTTCC

421GACCCCCGAGCGCGTGTAGGAGACACCGATAGATTGGCATCCGCCCCGATCGTAAAGTTG

481TGTAACGATCAAAAATGTTTCTGTGAGAGGCCATGAAGAATGACCGTCCCCTCCTGCATC

541ACCTCTATTT

Biobank

Physical sample preservation

Registered material from this specimen and how it is preserved. Exact freezer positions and rack locations are restricted to authorized staff.

Preserved samples

−80 °C / LN₂

Holding laboratories

Available

Herbarium sheet (algae)

SPC-M-0030

Preservation: Dry, room temperature
Quantity: 2 sheets
Preserved: 2016-05-28

Marine Science Centre — Wet Lab (Demo)

Sample lifecycle

01 Field sampling02 Registration03 Preservation04 Molecular work

2016-05-18 · Field sampling — Ras al Jinz, Ash Sharqiyah — collected at 2.1 m.

2016-05-28 · Registration — Registered at National Heritage Collection (Demo) as OMN-MAR-0030.

2016-05-28 · Preservation — Material preserved: Dry, room temperature.

2016-06-11 · Molecular work — DNA extraction and barcoding (demo).

Sample identifiers, quantities and laboratories are synthetic demonstration values; no storage monitoring history is claimed.

Research

Research & provenance

How this record came to be, and literature linked to it.

Data provenance

Sampling event
Ras al Jinz, 2016-05-18 · 2.1 m · by S. Al-Rawahi
Curated record
National Heritage Collection (Demo)
Preserved material
1 sample across 1 laboratories (demo)
Research data
DNA barcoding (demo) · Biochemical extracts (demo)

No publications linked

Publications citing this specimen will appear here once they are added by the holding institution.

More marine algae

Padina boergesenii

OMN-MAR-0005 · Duqm

Padina boergesenii

OMN-MAR-0007 · Bandar Khayran

Padina boergesenii

OMN-MAR-0008 · Hallaniyat Islands

Sargassum ilicifolium

OMN-MAR-0010 · Hallaniyat Islands

Ulva lactuca

OMN-MAR-0011 · Daymaniyat Islands

Sargassum ilicifolium

OMN-MAR-0015 · Bandar Khayran

Ulva lactuca

OMN-MAR-0022 · Khor Ash Sham

Padina boergesenii

OMN-MAR-0024 · Masirah Island