Representative soft corals image — not this exact specimenSoft coral

Soft coralsAvailable Demonstration data

Sarcophyton glaucum

Leather coral

Accession: OMN-MAR-0058

Family: Sarcophytidae
Category: Soft corals
Geographic origin: Daymaniyat Islands, Al Batinah
Sampling depth: 13.7 m
Collection date: 2014-11-19
Holding institution: Marine Science Centre (Demo)

Overview

Scientific identity

All values on this page are synthetic demonstration data, generated for this prototype.

Taxonomy

AnimaliaCnidariaOctocoralliaMalacalcyonaceaSarcophytidaeSarcophytonSarcophyton glaucum

Colony form

Encrusting base with a broad, lobed capitate polyparium.

Polyps

Retractile polyps distributed over the colony surface.

Colour in life

Cream to greyish

Resource network

This record

OMN-MAR-0058

Each node jumps to its section on this page.

GIS & sampling

Sampling location & depth

Where this organism was collected, and at what depth in the water column.

Loading map of Oman…

Daymaniyat Islands, Al Batinah · Coral reef, island shelf · 11 records of this speciesOpen geographic explorer

Sampling depth explorer

0 m50 m

13.7 m · this record

0 m50 m

27.9 m

0 m50 m

20.7 m

0 m50 m

31.1 m

0 m50 m

25.8 m

Recorded depth: 13.7 m
Sampling method: SCUBA survey

Schematic depth scale — no bathymetric profile is claimed. Other columns are recorded depths of the same species (demo).

Environment

Water conditions at sampling

Single set of measurements recorded during the sampling event on 2014-11-19 — not a monitoring series.

Water temperature

26.6 °C

Recorded at sampling · Daymaniyat Islands, Al Batinah

Sampling depth 13.7 m · SCUBA survey

Values are synthetic demonstration measurements with realistic units; no time series exists to chart.

Biochemistry

Extract & compound explorer

Select an extract to see its fractions and any assay results. All entries are synthetic demonstration data — no bioactivity is claimed.

OMN-MAR-0058→EXT-0058-M→CPD-0058-1→1 assay

Isolated fractions · EXT-0058-M

Polar fraction from liquid–liquid partitioning. Structural elucidation pending — no formula or structure is claimed.

Bioactivity assays

Antibacterial screening (disk diffusion)

ASY-0058-1

Target: Reference bacterial panel

No inhibition zone recorded

Negative result at tested concentration (demo). No bioactivity is claimed.

No chromatograms or spectra are held for these extracts, so none are drawn. Compound identities, formulas and structures remain unclaimed until characterization is complete.

Genomics

Genomic data

DNA barcodes and sequence records linked to this specimen. Sequences are synthetic demonstration output, not real results.

DNA barcodeBOLD:DEMO0058· demonstration barcode identifier, no external database record

Molecular markers

Sequenced (demo)

Marker: Cytochrome c oxidase I (DNA barcode)
Type: Mitochondrial barcode
Sequence ID: OMN-MAR-0058_COI
Length: 658 bp

Synthetic demonstration sequence — not a real sequencing result.

Sequence viewer · COI

1TAGCTTGTGTCGGGAGAAGCACTTAGGCTAGGGGCGCGTCAGCTCGACCTACAAACGGAG

61GGCGTTCAATAACGATGGAGACTGGCCGATTTAAGTAAAGAGGGGACGATTTAATTACCC

121CGGTGGCCCCGTTTATAATGAGTTGCCCGCGCAATCAAATAGTCATGATAGGTAGGGGCG

181TCTGAATCCAGATAATGTTGGGTCTTCCCATGTCTAAGCTGAATATTAGGAGTGCCTCTC

241CAGCCGCAACATCGCAGCAAACACTGACAGCACCGAAGTGGTGGGAGTCCTTTCGAAGGG

301AATGTTAATTCTTTGAGCGTCCGGGTACCGATATGGTTGGCTGACACCTATCAGTCGTCC

361ATCCAAACGGACGCACACATTAACCATTCGCTTGACCCACTACTCATAGCAAGAGCATCC

421TTAACCTCGTAAAGAGCTCTTGTACCCCTTTTGGTAGAGTGAACTCAAACTGAGGCCTTT

481AACTCGGCCCGGGTAAGCAGAAAAAGAATGCCAGTACAAATAAACTCGATGTTCGGATGC

541CACTTAATACAGTACCAGACATCGGGCCGAACTAGTCTACGCATCTTGGACGTTGGGCGC

601AAATGGGCTACACGTGGCAGGTCGATTTGCTTAGTCGCCTATAGTGTTCATTTGGTGG

Biobank

Physical sample preservation

Registered material from this specimen and how it is preserved. Exact freezer positions and rack locations are restricted to authorized staff.

Preserved samples

−80 °C / LN₂

Holding laboratories

Available

Ethanol-preserved specimen

SPC-M-0058

Preservation: Ethanol, room temperature
Quantity: 2 items
Preserved: 2014-11-23

National Heritage Collection — Store (Demo)

Available

Frozen tissue for DNA

TIS-M-0058

Preservation: −80 °C freezer
Quantity: 3 tubes
Preserved: 2015-01-15

National Heritage Collection — Store (Demo)

Sample lifecycle

01 Field sampling02 Registration03 Preservation04 Molecular work

2014-11-19 · Field sampling — Daymaniyat Islands, Al Batinah — collected at 13.7 m.

2014-11-23 · Registration — Registered at Marine Science Centre (Demo) as OMN-MAR-0058.

2014-11-23 · Preservation — Material preserved: Ethanol, room temperature · −80 °C freezer.

2015-01-15 · Molecular work — DNA extraction and barcoding (demo).

Sample identifiers, quantities and laboratories are synthetic demonstration values; no storage monitoring history is claimed.

Research

Research & provenance

How this record came to be, and literature linked to it.

Data provenance

Sampling event
Daymaniyat Islands, 2014-11-19 · 13.7 m · by R. Al-Kindi
Curated record
Marine Science Centre (Demo)
Preserved material
2 samples across 1 laboratories (demo)
Research data
DNA barcoding (demo) · Biochemical extracts (demo)

No publications linked

Publications citing this specimen will appear here once they are added by the holding institution.

More soft corals

Sinularia polydactyla

OMN-MAR-0001 · Ras al Jinz

Sarcophyton glaucum

OMN-MAR-0004 · Daymaniyat Islands

Sinularia polydactyla

OMN-MAR-0018 · Daymaniyat Islands

Sinularia polydactyla

OMN-MAR-0032 · Ras al Jinz

Sinularia polydactyla

OMN-MAR-0038 · Khor Ash Sham

Sarcophyton glaucum

OMN-MAR-0039 · Hallaniyat Islands

Sinularia polydactyla

OMN-MAR-0042 · Masirah Island

Sarcophyton glaucum

OMN-MAR-0043 · Bandar Khayran