Representative soft corals image — not this exact specimenSoft coral

Soft coralsRestricted Demonstration data

Sinularia polydactyla

Finger leather coral

Accession: OMN-MAR-0111

Family: Sinulariidae
Category: Soft corals
Geographic origin: Hallaniyat Islands, Dhofar
Sampling depth: 10.1 m
Collection date: 2017-12-06
Holding institution: National Heritage Collection (Demo)

Overview

Scientific identity

All values on this page are synthetic demonstration data, generated for this prototype.

Taxonomy

AnimaliaCnidariaOctocoralliaMalacalcyonaceaSinulariidaeSinulariaSinularia polydactyla

Colony form

Erect, finger-like lobes.

Polyps

Retractile polyps distributed over the colony surface.

Colour in life

Greenish-brown

Resource network

This record

OMN-MAR-0111

Each node jumps to its section on this page.

GIS & sampling

Sampling location & depth

This record is restricted: its location is shown generalised to protect sensitive material.

Loading map of Oman…

Hallaniyat Islands, Dhofar · Remote island reef · 8 records of this speciesOpen geographic explorer

Sampling depth explorer

0 m50 m

10.1 m · this record

0 m50 m

16 m

0 m50 m

13.4 m

0 m50 m

11.9 m

0 m50 m

33.7 m

Recorded depth: 10.1 m
Sampling method: SCUBA survey

Schematic depth scale — no bathymetric profile is claimed. Other columns are recorded depths of the same species (demo).

Environment

Water conditions at sampling

Single set of measurements recorded during the sampling event on 2017-12-06 — not a monitoring series.

Water temperature

27.6 °C

Recorded at sampling · Hallaniyat Islands, Dhofar

Sampling depth 10.1 m · SCUBA survey

Values are synthetic demonstration measurements with realistic units; no time series exists to chart.

Biochemistry

Extract & compound explorer

Select an extract to see its fractions and any assay results. All entries are synthetic demonstration data — no bioactivity is claimed.

OMN-MAR-0111→EXT-0111-M→CPD-0111-1→1 assay

Isolated fractions · EXT-0111-M

Polar fraction from liquid–liquid partitioning. Structural elucidation pending — no formula or structure is claimed.

Bioactivity assays

Antibacterial screening (disk diffusion)

ASY-0111-1

Target: Reference bacterial panel

No inhibition zone recorded

Negative result at tested concentration (demo). No bioactivity is claimed.

No chromatograms or spectra are held for these extracts, so none are drawn. Compound identities, formulas and structures remain unclaimed until characterization is complete.

Genomics

Genomic data

DNA barcodes and sequence records linked to this specimen. Sequences are synthetic demonstration output, not real results.

DNA barcodeBOLD:DEMO0111· demonstration barcode identifier, no external database record

Molecular markers

Sequenced (demo)

Marker: Cytochrome c oxidase I (DNA barcode)
Type: Mitochondrial barcode
Sequence ID: OMN-MAR-0111_COI
Length: 658 bp

Synthetic demonstration sequence — not a real sequencing result.

Sequence viewer · COI

1AAGAACGGCCAGACTATTGGCCCGTCATCCAATTAAATAGAGCACGAAACCTGACAACAT

61GGGACCGGGCACACCTTTTAGTTATGGTACGCAAATACCGAAACCAGGCAATTTAGTTTT

121ATGACCGCACTCGGGCGGCAATCCTGGCACCATATAGAGAGCCACTGCCGAGCAGCATGG

181CCACTACACCCTCCTGACTGCATGCGATATCGGATGAGTTAGAAGAGATAGCGAGTTCCA

241GCGACGTTCGAGTCATCGTGACCAAATTTATGTTGATTTGAACTTCGTTTAGTGAGTCAG

301ACGTCAGATGTGTACCTACGGCGCACCCGGGACCCTGCACTACTACTCTCCCATGTTGCT

361CGAGATTCCGTTAGATCTATTGATGGATTTCGAAGTAGAACCAATTACATAGACAATCCC

421GTTGCCCTATATTTTTCCCCCAGTCACTTTACTTAAAGGTTCCTGACGGAGTAAGATTTC

481CACCAGCGCCGAACGTACATCGAGCCCGAATCCCACTACTCTTTATAGCACACGTCACTG

541CGGAATTGAGACCCACTATGGCCGGGCTAAAAGTGTATTCACATGCGTTCCATCAAGTAA

601TGTTACGCGGCTGTTATACTAAAACCCGGAATTTGCACTCGATTAATATGATATACGC

Biobank

Physical sample preservation

Registered material from this specimen and how it is preserved. Exact freezer positions and rack locations are restricted to authorized staff.

Preserved samples

−80 °C / LN₂

Holding laboratories

Available

Ethanol-preserved specimen

SPC-M-0111

Preservation: Ethanol, room temperature
Quantity: 2 items
Preserved: 2017-12-07

Marine Science Centre — Wet Lab (Demo)

Available

Frozen tissue for DNA

TIS-M-0111

Preservation: Liquid nitrogen
Quantity: 3 tubes
Preserved: 2018-01-12

Marine Science Centre — Wet Lab (Demo)

Sample lifecycle

01 Field sampling02 Registration03 Preservation04 Molecular work

2017-12-06 · Field sampling — Hallaniyat Islands, Dhofar — collected at 10.1 m.

2017-12-07 · Registration — Registered at National Heritage Collection (Demo) as OMN-MAR-0111.

2017-12-07 · Preservation — Material preserved: Ethanol, room temperature · Liquid nitrogen.

2018-01-12 · Molecular work — DNA extraction and barcoding (demo).

Sample identifiers, quantities and laboratories are synthetic demonstration values; no storage monitoring history is claimed.

Research

Research & provenance

How this record came to be, and literature linked to it.

Data provenance

Sampling event
Hallaniyat Islands, 2017-12-06 · 10.1 m · by K. Al-Busaidi
Curated record
National Heritage Collection (Demo)
Preserved material
2 samples across 1 laboratories (demo)
Research data
DNA barcoding (demo) · Biochemical extracts (demo)

No publications linked

Publications citing this specimen will appear here once they are added by the holding institution.

More soft corals

Sinularia polydactyla

OMN-MAR-0001 · Ras al Jinz

Sarcophyton glaucum

OMN-MAR-0004 · Daymaniyat Islands

Sinularia polydactyla

OMN-MAR-0018 · Daymaniyat Islands

Sinularia polydactyla

OMN-MAR-0032 · Ras al Jinz

Sinularia polydactyla

OMN-MAR-0038 · Khor Ash Sham

Sarcophyton glaucum

OMN-MAR-0039 · Hallaniyat Islands

Sinularia polydactyla

OMN-MAR-0042 · Masirah Island

Sarcophyton glaucum

OMN-MAR-0043 · Bandar Khayran